Previous Next

2 Feb, 2019

Een kleine vergroting voor een kleine prijs

444

7

0

2019 goed gestart?  Super! Of toch nog iets nodig om je voornemens een kickstart te geven? Foto Schelfhout heeft alles in huis om in de maand februari alles uit je foto's te blijven halen!

In februari 13cm en 15 cm aan €1 ipv €1,5 dus een kleine vergroting voor een kleine prijs.

Bestel nu online: http://fotoschelfhout.be/items/item/71/Foto+op+Minilab

7 Reacties

• epicysnip
  17 augustus, 2022
  buy accutane online 20mg ivermectin pills for sale Mayo Clinic Online Propecia
• acidorp
  27 oktober, 2022
  Expression of Myostatin mRNA was analyzed by qRT PCR using primers 5 AGTGGATCTAAATGAGGGCAGT 3 forward and 5 GTTTCCAGGCGCAGCTTAC 3 reverse buy stromectol tablets Mice, experimental treatments and tumorigenesis studies
• shesque
  06 november, 2022
  nafcillin decreases levels of nicardipine by increasing metabolism buy priligy pills
• ToobeQuow
  08 november, 2022
  tamoxifen dosage bodybuilding PMID 30928160 PMC PMC6764911 DOI 10
• Vodsdoody
  13 november, 2022
  Ryan, once a member of the Ravens defensive coaching staff, voiced his opinion in favor of Joe Flacco that essentially went ignored buy clomid online safely 1990; 150 3 597 601
• Untonry
  15 november, 2022
  2018 10 08; 34 4 529 530 can you take bumex and lasix together Markus ImqTafhaItDDDjoGM 5 20 2022
• MealeHice
  20 november, 2022
  There are some of the most common or important side effects oracea